• BUDGET SAVER — Save $50 on every ELISA kit. Limited-time deal.

Home Products Lentivirus pLenti-U6-TRIM11(human)-sgRNA3-Cas9-Puro
Catalog No. BV-P91661

pLenti-U6-TRIM11(human)-sgRNA3-Cas9-Puro

Gene Editing CRISPR Mammalian Cells In Stock

Gene Editing tool built on a Mammalian Cells backbone, carrying a CRISPR insert for Human.

Overview

  • Vector Type

    Mammalian Cells / Lentivirus

  • Insert Type

    CRISPR

  • Target Species

    Human

  • Promoter

    U6

  • Selection Marker

    Puromycin

  • Copy Number

    High
PURIFICATION GRADE
  • Standard
Price per package $25.00 ≈ $0.40 per µg
Ships in 3–5 business days
Request a Bulk Quote
  • Validated Titer

    Measured by ddPCR

  • Full Plasmid Map

    GenBank + datasheet included

  • QC Guaranteed

    Sterility + endotoxin tested

Catalog Number BV-P91661
Bacterial Resistance Ampicillin
Mammalian Selection Marker Puromycin
Origin of Replication pUC
Copy Number (E. coli) High
Competent Cell Strain Stbl3
Recommended Growth Temperature 37°C
Target Sequence / Alias gactggtagagacactgcgg
Forward Primer U6-F(hairpin structure)
Total Plasmid Length 13013 bp

Full Sequence

13,013 bp

Don't See the Construct You Want?

Let us do the heavy lifting. We offer expert sourcing for hard-to-find clones and fully customizable antibody solutions to perfectly align with your research goals.

Talk to Our Experts

Promotions

Related Products

View More Products

Can't Find the Construct? We'll Build It.

Send us your sequence or target and a vector scientist returns a quote and timeline within one business day.

Request a Quote
+1 (888) 555-0142